-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25642 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDF1-MCS2-EF1-Puro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 6606
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein tyrosine phosphatase receptor-type delta
-
Alt namePTPRD
-
Alt namePTP delta
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5140
-
MutationAn NsiI restriction site was engineered into the multiple cloning site of the pCDF1-MCS2-EF1-Puro vector by site-directed mutagenesis. The PTPRD cDNA with flanking NsiI restriction sites was then cloned into this NsiI site in pCDF1.
-
GenBank IDBC106714
-
Entrez GenePTPRD (a.k.a. HPTP, HPTPD, HPTPDELTA, PTPD, R-PTP-delta, RPTPDELTA)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer atccacgctgttttgacctc
- 3′ sequencing primer ccaacttctcggggactgt (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF1-PTPRD-WT was a gift from Todd Waldman (Addgene plasmid # 25642 ; http://n2t.net/addgene:25642 ; RRID:Addgene_25642) -
For your References section:
Mutational inactivation of PTPRD in glioblastoma multiforme and malignant melanoma. Solomon DA, Kim JS, Cronin JC, Sibenaller Z, Ryken T, Rosenberg SA, Ressom H, Jean W, Bigner D, Yan H, Samuels Y, Waldman T. Cancer Res. 2008 Dec 15. 68(24):10300-6. 10.1158/0008-5472.CAN-08-3272 PubMed 19074898