LentiCRISPRv2GFP
(Plasmid #82416)

• Purpose: 3rd generation lentiviral vector expressing GFP alongside Cas9 and an sgRNA cloning site
• Depositing Lab: David Feldser
• Publication: Walter et al Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi: 10.1158/0008-5472.CAN-16-2159.
• Citations: 127 Articles

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone manufacturer: Feng Zhang
• Total vector size (bp): 13129
• Modifications to backbone: Cloned in GFP to replace Puro resistance
• Vector type: Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GFP
• Alt name: EGFP
• Species: Aequorea victoria
• Insert Size (bp): 720
• Promoter: EFS (P2A)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGGTGTCTAAGGGCGAAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA of choice is cloned into vector using Golden Gate assembly, with BsmBI restriction enzyme (as per resource information on Addgene plasmid #52961 by Feng Zhang). Note: This plasmid does not contain a 2KB stuffer sequence between the BsmBI sites.

sgRNA sequencing primer is as follows: 5'-TACGTGACGTAGAAAGTA