Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #25644)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 25644 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 6606
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Protein tyrosine phosphatase receptor-type delta
  • Alt name
  • Alt name
    PTP delta
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    tumor-derived mutation created by site-directed mutagenesis: nucleotide C1518T, amino acid P459L (annotated according to Ensembl transcript ENST00000381196)
  • GenBank ID
    BC106714 NP_569075
  • Entrez Gene

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer atccacgctgttttgacctc
  • 3′ sequencing primer ccaacttctcggggactgt
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF1-PTPRD-P459L was a gift from Todd Waldman (Addgene plasmid # 25644 ; ; RRID:Addgene_25644)
  • For your References section:

    Mutational inactivation of PTPRD in glioblastoma multiforme and malignant melanoma. Solomon DA, Kim JS, Cronin JC, Sibenaller Z, Ryken T, Rosenberg SA, Ressom H, Jean W, Bigner D, Yan H, Samuels Y, Waldman T. Cancer Res. 2008 Dec 15. 68(24):10300-6. 10.1158/0008-5472.CAN-08-3272 PubMed 19074898