-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32564 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4727
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Bak
-
Alt namebCL2-antagonist/killer 1
-
Alt nameBCL2L7
-
Alt nameBAK1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)636
-
GenBank IDNM_001188
-
Entrez GeneBAK1 (a.k.a. BAK, BAK-LIKE, BCL2L7, CDN1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Kpn I (not destroyed)
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CTACAAATGTGGTATGGCTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Bak was a gift from Richard Youle (Addgene plasmid # 32564 ; http://n2t.net/addgene:32564 ; RRID:Addgene_32564) -
For your References section:
Bax and Bak coalesce into novel mitochondria-associated clusters during apoptosis. Nechushtan A, Smith CL, Lamensdorf I, Yoon SH, Youle RJ. J Cell Biol. 2001 Jun 11. 153(6):1265-76. 10.1083/jcb.153.6.1265 PubMed 11402069