Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32564)


Item Catalog # Description Quantity Price (USD)
Plasmid 32564 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4727
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    human Bak
  • Alt name
    bCL2-antagonist/killer 1
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    BAK1 (a.k.a. BAK, BAK-LIKE, BCL2L7, CDN1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site Kpn I (not destroyed)
  • 5′ sequencing primer AGAAGCGCGATCACATGG
  • 3′ sequencing primer CTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Bak was a gift from Richard Youle (Addgene plasmid # 32564 ; ; RRID:Addgene_32564)
  • For your References section:

    Bax and Bak coalesce into novel mitochondria-associated clusters during apoptosis. Nechushtan A, Smith CL, Lamensdorf I, Yoon SH, Youle RJ. J Cell Biol. 2001 Jun 11. 153(6):1265-76. 10.1083/jcb.153.6.1265 PubMed 11402069