punc-119cbr
(Plasmid
#32568)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepunc-119c
- Backbone size w/o insert (bp) 1413
-
Vector typeWorm Expression
-
Selectable markersunc-119 (C. briggsae)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameunc-119
-
Alt nameCbr-unc-119
-
SpeciesC. briggsae
-
Insert Size (bp)2155
-
GenBank IDU45326.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byC. briggsae unc-119 gene was PCR amplified from pCFJ151.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid is similar to punc-119c but has C. briggsae unc-119 genomic DNA in place of C. elegans unc-119 promoter and cDNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
punc-119cbr was a gift from Al Fisher (Addgene plasmid # 32568 ; http://n2t.net/addgene:32568 ; RRID:Addgene_32568) -
For your References section:
Improved vectors for selection of transgenic Caenorhabditis elegans. Ferguson AA, Cai L, Kashyap L, Fisher AL. Methods Mol Biol. 2013;940:87-102. doi: 10.1007/978-1-62703-110-3_8. 10.1007/978-1-62703-110-3_8 PubMed 23104336