pENTR-R4r-LucmiR-EGFP-R3r
              
              
                (Plasmid
                
                #32589)
              
            
            
            
          - 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDONR221 P4r-P3r
- 
              Backbone manufacturerInvitrogen
- 
              Vector typeGateway cloning vector
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)Stbl2
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameIntronic Luciferase miRNA and EGFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 Forward (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made bypSM155-Luc-GFP was provided by Guangwei Du, University of Texas Health Science Center, Houston. A cassette containing the intronic Luciferase miRNA upstream of EGFP was then amplified with PCR primers containing att sites and recombined to generate the entry vector.
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Luc miRNA atttgtattcagcccatatcgg
Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pENTR-R4r-LucmiR-EGFP-R3r was a gift from Matthew Nolan (Addgene plasmid # 32589 ; http://n2t.net/addgene:32589 ; RRID:Addgene_32589)
- 
                For your References section: A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo. White MD, Milne RV, Nolan MF. Front Mol Neurosci. 2011;4:8. Epub 2011 Jul 4. 10.3389/fnmol.2011.00008 PubMed 21772812
