aTRE
(Plasmid
#32612)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneStagia3
-
Backbone manufacturerMark Emerson
- Backbone size w/o insert (bp) 6610
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThyroid Response Element
-
Alt nameTRE
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTTCCGCGCACATTTCCCCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aTRE was a gift from Connie Cepko (Addgene plasmid # 32612 ; http://n2t.net/addgene:32612 ; RRID:Addgene_32612) -
For your References section:
Analysis of thyroid response element activity during retinal development. Billings NA, Emerson MM, Cepko CL. PLoS One. 2010 . 5(10):e13739. 10.1371/journal.pone.0013739 PubMed 21060789