TRalpha shRNA #1
              
              
                (Plasmid
                
                #32619)
              
            
            
            
          - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRFP RNAiC-1
 - 
              Vector typeRNAi
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameTRalpha shRNA #1
 - 
                    gRNA/shRNA sequenceGCAAGTCGCTGTCTGCCTTCAA
 - 
                    SpeciesG. gallus (chicken)
 - 
                    GenBank IDNM_205313
 - 
                        Entrez GeneTHRA (a.k.a. NR1A1)
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site NheI (not destroyed)
 - 3′ cloning site MluI (not destroyed)
 - 5′ sequencing primer Unknown (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
TRalpha shRNA #1 was a gift from Connie Cepko (Addgene plasmid # 32619 ; http://n2t.net/addgene:32619 ; RRID:Addgene_32619) - 
                
For your References section:
Analysis of thyroid response element activity during retinal development. Billings NA, Emerson MM, Cepko CL. PLoS One. 2010 . 5(10):e13739. 10.1371/journal.pone.0013739 PubMed 21060789