pAAV-SEPT-FLAG-PTEN KI vector
(Plasmid
#32808)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-SEPT
-
Vector typeMammalian Expression, Bacterial Expression, AAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1000
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, PTENgama, TEP1)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age I (not destroyed)
- 3′ cloning site Sac I (not destroyed)
- 5′ sequencing primer GGGAGGTGTGGGAGGTTTT
- 3′ sequencing primer GGAGTACTCACCCCAACAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SEPT-FLAG-PTEN KI vector was a gift from Todd Waldman (Addgene plasmid # 32808) -
For your References section:
Epitope tagging of endogenous genes in diverse human cell lines. Kim JS, Bonifant C, Bunz F, Lane WS, Waldman T. Nucleic Acids Res. 2008 Nov . 36(19):e127. 10.1093/nar/gkn566 PubMed 18784188