pCTX-myc-HIPK2 KD
(Plasmid
#32997)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCTX-myc
-
Backbone manufacturerSergei Sokol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHIPK2
-
SpeciesX. laevis (frog)
-
MutationK217>R (in the catalytic lysine) and STY348-350>AAF (in the activation loop)
-
Entrez Genehipk2
- Promoter SCMV
-
Tag
/ Fusion Protein
- 6XMyc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer SP6; xHIPK2-R (ttaatgccggtctcgttttc)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note from depositing lab: The X. laevis catalytic K217 residue corresponds to the mouse catalytic residue K221, in which a similar mutation, K221A, has been previously investigated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCTX-myc-HIPK2 KD was a gift from Sergei Sokol (Addgene plasmid # 32997 ; http://n2t.net/addgene:32997 ; RRID:Addgene_32997) -
For your References section:
Regulation of TCF3 by Wnt-dependent phosphorylation during vertebrate axis specification. Hikasa H, Ezan J, Itoh K, Li X, Klymkowsky MW, Sokol SY. Dev Cell. 2010 Oct 19;19(4):521-32. 10.1016/j.devcel.2010.09.005 PubMed 20951344
Map uploaded by the depositor.