Skip to main content

pCTX-myc-HIPK2 KD
(Plasmid #32997)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32997 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCTX-myc
  • Backbone manufacturer
    Sergei Sokol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HIPK2
  • Species
    X. laevis (frog)
  • Mutation
    K217>R (in the catalytic lysine) and STY348-350>AAF (in the activation loop)
  • Entrez Gene
    hipk2
  • Promoter SCMV
  • Tag / Fusion Protein
    • 6XMyc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SP6; xHIPK2-R (ttaatgccggtctcgttttc)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note from depositing lab: The X. laevis catalytic K217 residue corresponds to the mouse catalytic residue K221, in which a similar mutation, K221A, has been previously investigated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCTX-myc-HIPK2 KD was a gift from Sergei Sokol (Addgene plasmid # 32997 ; http://n2t.net/addgene:32997 ; RRID:Addgene_32997)
  • For your References section:

    Regulation of TCF3 by Wnt-dependent phosphorylation during vertebrate axis specification. Hikasa H, Ezan J, Itoh K, Li X, Klymkowsky MW, Sokol SY. Dev Cell. 2010 Oct 19;19(4):521-32. 10.1016/j.devcel.2010.09.005 PubMed 20951344