pCS2+8NmCherry-ABCB4a
(Plasmid
#34941)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 34941 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+8NmCherry
-
Backbone manufacturerGokirmak et al., 2012
- Backbone size w/o insert (bp) 4851
-
Vector typeMammalian Expression ; Sea urchin, zebrafish, Xenopus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameABCB4a
-
Alt nameMDR3
-
SpeciesStrongylocentrotus purpuratus
-
Insert Size (bp)3897
- Promoter SP6
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTTGAAGCTGTCCTTCCCCGA
- 3′ sequencing primer TGTTGTTAACTTGTTTATTGCAGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+8NmCherry-ABCB4a was a gift from Amro Hamdoun (Addgene plasmid # 34941 ; http://n2t.net/addgene:34941 ; RRID:Addgene_34941) -
For your References section:
Localization and Substrate Selectivity of Sea Urchin Multidrug (MDR) Efflux Transporters. Gokirmak T, Campanale JP, Shipp LE, Moy GW, Tao H, Hamdoun A. J Biol Chem. 2012 Nov 2. 10.1074/jbc.M112.424879 PubMed 23124201