Skip to main content

Gli1
(Plasmid #34996)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34996 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCCL-cppt-PGK-WPRE
  • Backbone manufacturer
    Malin Parmar
  • Backbone size w/o insert (bp) 7041
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Zinc finger protein GLI1
  • Alt name
    Gli1
  • Alt name
    Glioma-associated oncogene family zinc finger 1
  • Alt name
    Glioma-associated oncogene homolog 1 (zinc finger protein)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3336
  • GenBank ID
    NT_039500.7
  • Entrez Gene
    Gli1 (a.k.a. Zfp-5, Zfp5)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GAGGAGCCAGAGGTTGGAACT
  • 3′ sequencing primer GTATCAGTGGAGGAAAAATCCATGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Gli1 was a gift from Malin Parmar (Addgene plasmid # 34996)
  • For your References section:

    Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515