-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMVShuttle
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 8200
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTIN2
-
SpeciesH. sapiens (human)
-
Entrez GeneTINF2 (a.k.a. DKCA3, TIN2)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG-HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer ggtctatataagcagagctg
- 3′ sequencing primer ctgatcataatcagccataccac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJUDY CAMPISI
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pShuttle-HA-FLAG-TIN2 was a gift from Sheila Stewart (Addgene plasmid # 35025 ; http://n2t.net/addgene:35025 ; RRID:Addgene_35025) -
For your References section:
Revealing novel telomere proteins using in vivo cross-linking, tandem affinity purification, and label-free quantitative LC-FTICR-MS. Nittis T, Guittat L, LeDuc RD, Dao B, Duxin JP, Rohrs H, Townsend RR, Stewart SA. Mol Cell Proteomics. 2010 Jun;9(6):1144-56. Epub 2010 Jan 22. 10.1074/mcp.M900490-MCP200 PubMed 20097687