Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pShuttle-HA-FLAG-TIN2
(Plasmid #35025)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35025 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMVShuttle
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 8200
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TIN2
  • Species
    H. sapiens (human)
  • Entrez Gene
    TINF2 (a.k.a. DKCA3, TIN2)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG-HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer ggtctatataagcagagctg
  • 3′ sequencing primer ctgatcataatcagccataccac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    JUDY CAMPISI

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pShuttle-HA-FLAG-TIN2 was a gift from Sheila Stewart (Addgene plasmid # 35025 ; http://n2t.net/addgene:35025 ; RRID:Addgene_35025)
  • For your References section:

    Revealing novel telomere proteins using in vivo cross-linking, tandem affinity purification, and label-free quantitative LC-FTICR-MS. Nittis T, Guittat L, LeDuc RD, Dao B, Duxin JP, Rohrs H, Townsend RR, Stewart SA. Mol Cell Proteomics. 2010 Jun;9(6):1144-56. Epub 2010 Jan 22. 10.1074/mcp.M900490-MCP200 PubMed 20097687