Skip to main content

nSR100L4
(Plasmid #35174)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35174 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MmnSR100
  • gRNA/shRNA sequence
    CCGGGCTCACAGTATATCTCCTAAACTCGAGTTTAGGAGATATACTGTGAGCTTTTTG
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO1-5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nSR100L4 was a gift from Benjamin Blencowe (Addgene plasmid # 35174 ; http://n2t.net/addgene:35174 ; RRID:Addgene_35174)
  • For your References section:

    Regulation of vertebrate nervous system alternative splicing and development by an SR-related protein. Calarco JA, Superina S, O'Hanlon D, Gabut M, Raj B, Pan Q, Skalska U, Clarke L, Gelinas D, van der Kooy D, Zhen M, Ciruna B, Blencowe BJ. Cell. 2009 Sep 4;138(5):898-910. 10.1016/j.cell.2009.06.012 PubMed 19737518