Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBbA3a-RFP
(Plasmid #35307)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35307 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBb
  • Backbone size w/o insert (bp) 4003
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RFP
  • Alt name
    JBEI Part ID: JPUB_000073
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter ProS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer jkRFP-R (gctttggaaccgtactggaa)
  • 3′ sequencing primer jkRFP-F (tggtcactacgacgctgaag)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

JBEI Part ID: JPUB_000073; Origin: p15A

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbA3a-RFP was a gift from Jay Keasling (Addgene plasmid # 35307 ; http://n2t.net/addgene:35307 ; RRID:Addgene_35307)
  • For your References section:

    BglBrick vectors and datasheets: A synthetic biology platform for gene expression. Lee TS, Krupa RA, Zhang F, Hajimorad M, Holtz WJ, Prasad N, Lee SK, Keasling JD. J Biol Eng. 2011 Sep 20;5:12. 10.1186/1754-1611-5-12 PubMed 21933410