-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNSnoFbox-vhhGFP4
-
Alt nameslmb
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)795
-
MutationF box domain of slmb deleted.
-
GenBank IDAY118898
-
Entrez Geneslmb (a.k.a. Dmel_CG3412, BcDNA:GM02031, CG3412, Dmel\CG3412, FBXW1, MENE (3R)-B, MENE(3R)-B, SLIMB, SLMB, Slimb, Slimb/Beta-TRCP1, Slimb/beta-TRCP, Slimb/beta-TrCP, Slimb/betaTrCP, Slmb, beta-TrCP, betaTrCP, crd, ica, l(3)00295, shv, slimb, wel)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer atttaggtgacactatag
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3_NSnoFbox-vhhGFP4 was a gift from Markus Affolter (Addgene plasmid # 35580 ; http://n2t.net/addgene:35580 ; RRID:Addgene_35580) -
For your References section:
Fluorescent fusion protein knockout mediated by anti-GFP nanobody. Caussinus E, Kanca O, Affolter M. Nat Struct Mol Biol. 2011 Dec 11;19(1):117-21. doi: 10.1038/nsmb.2180. 10.1038/nsmb.2180 PubMed 22157958