pAAVf-EnhCB-lacZnls mir-122 1xBS
(Plasmid
#35643)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 35643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVf-EnhCB-lacZnls
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1 miR-122 target site
-
SpeciesSynthetic
-
Insert Size (bp)23
- Promoter CB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstB I (not destroyed)
- 3′ cloning site BstB I (not destroyed)
- 5′ sequencing primer TGAAGCTGAAGCCTGTGATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVf-EnhCB-lacZnls mir-122 1xBS was a gift from Phillip Zamore (Addgene plasmid # 35643 ; http://n2t.net/addgene:35643 ; RRID:Addgene_35643)