Skip to main content

pRNA-U6-TuD let-7
(Plasmid #35666)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35666 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRNA-U6.1/Neo-siFluc
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5124

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TuD let-7
  • Species
    Synthetic
  • Insert Size (bp)
    461
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer gagggcctatttcccatgat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRNA-U6-TuD let-7 was a gift from Phillip Zamore (Addgene plasmid # 35666)
  • For your References section:

    Long-term, efficient inhibition of microRNA function in mice using rAAV vectors. Xie J, Ameres SL, Friedline R, Hung JH, Zhang Y, Xie Q, Zhong L, Su Q, He R, Li M, Li H, Mu X, Zhang H, Broderick JA, Kim JK, Weng Z, Flotte TR, Zamore PD, Gao G. Nat Methods. 2012 Mar 4;9(4):403-9. doi: 10.1038/nmeth.1903. 10.1038/nmeth.1903 PubMed 22388288