-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 4300
-
Vector typeBAC recombineering
-
Selectable markersdiphtheria toxin A
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namediphtheria toxin A
-
Alt nameDT-A
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BssHII/StyI -> Resulting site can be cut with BssHII (not destroyed)
- 3′ cloning site BssHII/EcoRV (destroyed during cloning)
- 5′ sequencing primer mPGK_F_primer
- 3′ sequencing primer BGH rev
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPart of the sequence (the polylinker and the DT A cassette) was derived from Addgene plasmid# 19030 from Tyler Jacks lab.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be used for gap-repair mediated recovery of DNA sequences from BACs using recombineering technology and for gene targeting. It contains a eukaryotic diphtheria toxin A expression cassette driven by the PGK promoter and a modified polylinker cloned into the low copy number plasmid pBR322.
There are 8-base pair restriction enzyme sites for PacI, PmeI and SfiI in the polylinker.
The depositing lab has used these sequences as the homology sequences for amplifying the plasmid for gap repair:
5' CGATACCGTCGACCTCGAGG 3'
5' GCTTGATATCGAATTCTACC 3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBR.DT-A was a gift from Jacqueline Lees (Addgene plasmid # 35955 ; http://n2t.net/addgene:35955 ; RRID:Addgene_35955) -
For your References section:
E2f3a and E2f3b make overlapping but different contributions to total E2f3 activity. Danielian PS, Friesenhahn LB, Faust AM, West JC, Caron AM, Bronson RT, Lees JA. Oncogene. 2008 Nov 20;27(51):6561-70. Epub 2008 Jul 28. 10.1038/onc.2008.253 PubMed 18663357