pTrcHisA-rat-PTP1B
(Plasmid
#35987)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTrcHis A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4407
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprotein tyrosine phosphatase 1B
-
Alt namePTP1B
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1299
-
Entrez GenePtpn1 (a.k.a. Ptp)
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- Xpress Epitope Tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Bgl II (not destroyed)
- 5′ sequencing primer pTrcHis fwd GAGGTATATATTAATGTATCG
- 3′ sequencing primer pTrcHis rev CCTGATACAGATTAAATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGFP (EGFP)-PTP1B-HA construct was a gift from C. Arregui (University of San Martin, Buenos Aires, Argentina)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrcHisA-rat-PTP1B was a gift from Anna Huttenlocher (Addgene plasmid # 35987 ; http://n2t.net/addgene:35987 ; RRID:Addgene_35987) -
For your References section:
Calpain 2 and PTP1B function in a novel pathway with Src to regulate invadopodia dynamics and breast cancer cell invasion. Cortesio CL, Chan KT, Perrin BJ, Burton NO, Zhang S, Zhang ZY, Huttenlocher A. J Cell Biol. 2008 Mar 10;180(5):957-71. 10.1083/jcb.200708048 PubMed 18332219