pT7-7 asyn S87A
(Plasmid
#36058)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7-7
- Backbone size w/o insert (bp) 2438
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-synuclein S87A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)476
-
MutationS87A
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lashuel Lab Plasmid #79
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-7 asyn S87A was a gift from Hilal Lashuel (Addgene plasmid # 36058 ; http://n2t.net/addgene:36058 ; RRID:Addgene_36058) -
For your References section:
Phosphorylation at S87 is enhanced in synucleinopathies, inhibits alpha-synuclein oligomerization, and influences synuclein-membrane interactions. Paleologou KE, Oueslati A, Shakked G, Rospigliosi CC, Kim HY, Lamberto GR, Fernandez CO, Schmid A, Chegini F, Gai WP, Chiappe D, Moniatte M, Schneider BL, Aebischer P, Eliezer D, Zweckstetter M, Masliah E, Lashuel HA. J Neurosci. 2010 Mar 3;30(9):3184-98. 10.1523/JNEUROSCI.5922-09.2010 PubMed 20203178