Skip to main content

pT7-7 asyn S87E
(Plasmid #36059)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36059 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT7-7
  • Backbone size w/o insert (bp) 2438
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    alpha-synuclein S87E
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    476
  • Mutation
    S87E
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lashuel Lab Plasmid #80

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-7 asyn S87E was a gift from Hilal Lashuel (Addgene plasmid # 36059 ; http://n2t.net/addgene:36059 ; RRID:Addgene_36059)
  • For your References section:

    Phosphorylation at S87 is enhanced in synucleinopathies, inhibits alpha-synuclein oligomerization, and influences synuclein-membrane interactions. Paleologou KE, Oueslati A, Shakked G, Rospigliosi CC, Kim HY, Lamberto GR, Fernandez CO, Schmid A, Chegini F, Gai WP, Chiappe D, Moniatte M, Schneider BL, Aebischer P, Eliezer D, Zweckstetter M, Masliah E, Lashuel HA. J Neurosci. 2010 Mar 3;30(9):3184-98. 10.1523/JNEUROSCI.5922-09.2010 PubMed 20203178