pT7-7 asyn S129L
(Plasmid
#36062)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT7-7
- Backbone size w/o insert (bp) 2438
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-synuclein S129L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)476
-
MutationS129L
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lashuel Lab Plasmid #183
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-7 asyn S129L was a gift from Hilal Lashuel (Addgene plasmid # 36062 ; http://n2t.net/addgene:36062 ; RRID:Addgene_36062)