pAAV asyn S129E
(Plasmid
#36068)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4581
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-synuclein S129E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)484
-
MutationS129E
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer hGH rev (TAGGACAAGGCTGGTGGGCA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lashuel Lab Plasmid #525
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV asyn S129E was a gift from Hilal Lashuel (Addgene plasmid # 36068 ; http://n2t.net/addgene:36068 ; RRID:Addgene_36068)