YFP Gamma 9
(Plasmid
#36107)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6373
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG protein subunit Gamma 9
-
Alt nameGNG9
-
SpeciesB. taurus (bovine)
-
Insert Size (bp)210
-
MutationHIs tag between YFP and insert
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- YFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer TTAATACGACTCACTATAGGG
- 3′ sequencing primer GGAGGGGCAAACAACAGATGGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YFP Gamma 9 was a gift from Narasimhan Gautam (Addgene plasmid # 36107 ; http://n2t.net/addgene:36107 ; RRID:Addgene_36107) -
For your References section:
A family of G protein betagamma subunits translocate reversibly from the plasma membrane to endomembranes on receptor activation. Saini DK, Kalyanaraman V, Chisari M, Gautam N. J Biol Chem. 2007 Aug 17;282(33):24099-108. Epub 2007 Jun 20. 10.1074/jbc.M701191200 PubMed 17581822
Map uploaded by the depositor.