-
PurposeExpresses Sec16A as a GFP fusion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsDifficult to grow and prep without apparent loss of some of insert.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec16A
-
Alt nameKIAA0310
-
SpeciesH. sapiens (human)
-
Entrez GeneSEC16A (a.k.a. KIAA0310, SEC16L, p250)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGGGAGATCTATGCAGCCACCGCCCCAGACGG
- 3′ sequencing primer GGGGGAATTCTCAGTTCAGCACCAGGTGCTTCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOriginal insert from Kasuza as detailed in the attachment. Cloned by Peter Watson, now at University of Cardiff when he was a postdoc in the lab.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a D1555N mutation in Sec16A compared to the NCBI reference sequence NP_055681.1, this mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-Sec16A was a gift from David Stephens (Addgene plasmid # 36155 ; http://n2t.net/addgene:36155 ; RRID:Addgene_36155) -
For your References section:
Sec16 defines endoplasmic reticulum exit sites and is required for secretory cargo export in mammalian cells. Watson P, Townley AK, Koka P, Palmer KJ, Stephens DJ. Traffic. 2006 Dec;7(12):1678-87. Epub 2006 Sep 27. 10.1111/j.1600-0854.2006.00493.x PubMed 17005010