Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCY 3120-01
(Plasmid #36237)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36237 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBS7
  • Backbone manufacturer
    Yeast Resource Center, University of Washington
  • Backbone size w/o insert (bp) 4882
  • Vector type
    Yeast cassette for PCR and homologous recombination
  • Selectable markers
    Geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    yECitrine-7Myc
  • Insert Size (bp)
    1343
  • Tag / Fusion Protein
    • yEpolylinker-yECitrine-7Myc-kanMX (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BssHII (unknown if destroyed)
  • 5′ sequencing primer CCTTATGTATCATACACATACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid 8737 (Sheff, M. A. and Thorn, K. S. (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21, 661-70.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCY 3120-01 was a gift from Anne Robinson (Addgene plasmid # 36237 ; http://n2t.net/addgene:36237 ; RRID:Addgene_36237)
  • For your References section:

    Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young CL, Raden DL, Caplan JL, Czymmek KJ, Robinson AS. Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. 10.1002/yea.2895 PubMed 22473760