pHiKdtA
(Plasmid
#36269)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33.1
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH. influenzae KdtA
- Promoter araC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NedI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer 5’-GCAGCATATGTGGCGTTTTTTTTATACCAGCTTGC- 3’
- 3′ sequencing primer 5’- GCAGAAGCTTTCATACATTGCGCTCCAAATAAGGTTTT -3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHiKdtA was a gift from Christian Raetz (Addgene plasmid # 36269 ; http://n2t.net/addgene:36269 ; RRID:Addgene_36269) -
For your References section:
Interchangeable domains in the Kdo transferases of Escherichia coli and Haemophilus influenzae. Chung HS, Raetz CR. Biochemistry. 2010 May 18;49(19):4126-37. 10.1021/bi100343e PubMed 20394418