Skip to main content

pSMP-Luc
(Plasmid #36394)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36394 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSMP
  • Backbone manufacturer
    Steve Elledge
  • Backbone size w/o insert (bp) 6699
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • gRNA/shRNA sequence
    CCCGCCTGAAGTCTCTGATTAA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pSMP-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSMP-Luc was a gift from George Daley (Addgene plasmid # 36394 ; http://n2t.net/addgene:36394 ; RRID:Addgene_36394)
  • For your References section:

    Chromatin-modifying enzymes as modulators of reprogramming. Onder TT, Kara N, Cherry A, Sinha AU, Zhu N, Bernt KM, Cahan P, Marcarci BO, Unternaehrer J, Gupta PB, Lander ES, Armstrong SA, Daley GQ. Nature. 2012 Mar 4;483(7391):598-602. doi: 10.1038/nature10953. 10.1038/nature10953 PubMed 22388813