-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36949 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6873
- Total vector size (bp) 8180
-
Modifications to backbonethe plenti6-V5 GW LacZ backbone of Invitrogen was modified to delete the original lacz ORF as well as attR sites and V5-tag and replaced with the Flag-ORF
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEglN1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1307
-
MutationWildtype
-
Entrez GeneEGLN1 (a.k.a. C1orf12, ECYT3, HALAH, HIF-PH2, HIFPH2, HPH-2, HPH2, PHD2, SM20, ZMYND6)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba I (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer CMV-forward
- 3′ sequencing primer ACACCTGGTTGCTGACTAAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
this plasmid was constructed in the lab of a HHMI-investigator
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-EglN1-pLenti6 was a gift from William Kaelin (Addgene plasmid # 36949) -
For your References section:
Transformation by the (R)-enantiomer of 2-hydroxyglutarate linked to EGLN activation. Koivunen P, Lee S, Duncan CG, Lopez G, Lu G, Ramkissoon S, Losman JA, Joensuu P, Bergmann U, Gross S, Travins J, Weiss S, Looper R, Ligon KL, Verhaak RG, Yan H, Kaelin WG Jr. Nature. 2012 Feb 15;483(7390):484-8. doi: 10.1038/nature10898. 10.1038/nature10898 PubMed 22343896