p6671 MSCV-IP N-HAonly 38E6
(Plasmid
#37056)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37056 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV-IP N-HAonly
- Backbone size w/o insert (bp) 8100
-
Modifications to backbone(NTap mod. by E.White to remove Flag)
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHPV38 E6
-
SpeciesHuman Papillomavirus
-
Insert Size (bp)500
- Promoter MSCV LTR
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Retroviral vector for HA-tagged HPV38 E6 expression. No starting ATG in viral ORF, translation begins from tag only. Puro resistance protein expressed from an IRES
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6671 MSCV-IP N-HAonly 38E6 was a gift from Peter Howley (Addgene plasmid # 37056 ; http://n2t.net/addgene:37056 ; RRID:Addgene_37056) -
For your References section:
Cutaneous beta-human papillomavirus E6 proteins bind Mastermind-like coactivators and repress Notch signaling. Tan MJ, White EA, Sowa ME, Harper JW, Aster JC, Howley PM. Proc Natl Acad Sci U S A. 2012 Apr 30. 10.1073/pnas.1205991109 PubMed 22547818