Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-Hb9-GFP
(Plasmid #37080)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37080 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CSCspPW
  • Backbone manufacturer
    Inder Verma lab
  • Backbone size w/o insert (bp) 8466
  • Total vector size (bp) 12486
  • Modifications to backbone
    none
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    none
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Hb9 GFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4020
  • Promoter Hb9

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCTAGCTCCGGAGAGCAAAAGCTG
  • 3′ sequencing primer TGTAATCCAGAGGTTGATTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr.Sam Pfaff
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expresses GFP under the control of the Hb9 promoter to visualize postmitotic human motor neurons

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-Hb9-GFP was a gift from Fred Gage (Addgene plasmid # 37080 ; http://n2t.net/addgene:37080 ; RRID:Addgene_37080)
  • For your References section:

    Non-cell-autonomous effect of human SOD1 G37R astrocytes on motor neurons derived from human embryonic stem cells. Marchetto MC, Muotri AR, Mu Y, Smith AM, Cezar GG, Gage FH. Cell Stem Cell. 2008 Dec 4;3(6):649-57. 10.1016/j.stem.2008.10.001 PubMed 19041781