Skip to main content

pAAV-Ef1a-DIO-mCherry-WPRE-pA
(Plasmid #37083)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37083 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO-hChR2(H134R)-mCherry-WPRE-pA
  • Backbone manufacturer
    K. Deisseroth Lab
  • Backbone size w/o insert (bp) 5603
  • Total vector size (bp) 6314
  • Vector type
    AAV, Cre/Lox ; Cre-On

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Karl Deisseroth Lab, Stanford Univ.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO-mCherry-WPRE-pA was a gift from Bernardo Sabatini (Addgene plasmid # 37083 ; http://n2t.net/addgene:37083 ; RRID:Addgene_37083)
  • For your References section:

    Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in neurons. Saunders A, Johnson CA, Sabatini BL. Front Neural Circuits. 2012 Jul 27;6:47. doi: 10.3389/fncir.2012.00047. eCollection 2012. 10.3389/fncir.2012.00047 PubMed 22866029