This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37120)


Item Catalog # Description Quantity Price (USD)
Plasmid 37120 Plasmid sent as bacteria in agar stab 1 $65
AAV Retrograde 37120-AAVrg Virus (100µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    K. Deisseroth Lab
  • Backbone size w/o insert (bp) 5627
  • Total vector size (bp) 7778
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site Nhe1 (not destroyed)
  • 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

Information for AAV Retrograde (Catalog # 37120-AAVrg) ( Back to top )


Ready-to-use AAV Retrograde particles produced from pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (#37120). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA plasmid DNA.

Cre-dependent color-flipping reporter. Expresses tdTomato in the absence of Cre, but inverts to express EGFP in Cre-positive cells. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAVrg, encoded by rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene Cre-dependent color-flipping from tdTomato to EGFP


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • Confirmation of protein expression: AAV-Pro cells were transduced with 37120-AAVrg and an AAV delivering Cre recombinase. tdTomato expression was visualized by direct fluorescence with a Texas Red filter at 48 hours. Cre-dependent GFP expression and the loss of tdTomato expression was visualized by direct fluorescence at 1 week.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the original (non-flipped) orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
    • Orientation

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA was a gift from Bernardo Sabatini (Addgene plasmid # 37120)
  • For your References section:

    Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in neurons. Saunders A, Johnson CA and Sabatini BL. Front. Neural Circuits 6:47. doi: 10.3389/fncir.2012.00047 10.3389/fncir.2012.00047