pTAL13
(Plasmid
#37186)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA 3.1 (-)
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 8100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
-
Tag
/ Fusion Protein
- FokI (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TAL-F1: ttggcgtcggcaaacagtgg
- 3′ sequencing primer TAL-R2: GGCGACGAGGTGGTCGTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression of the TAL-FokI homodimer in mammalian cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTAL13 was a gift from Adam Bogdanove (Addgene plasmid # 37186 ; http://n2t.net/addgene:37186 ; RRID:Addgene_37186) -
For your References section:
Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687