-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZDonor AAVS1
-
Backbone manufacturerSigma
- Total vector size (bp) 4524
-
Modifications to backbonemouse Rosa26 targeting arms were PCR amplified and cloned in as described in the manuscript.
-
Vector typeGenomic targeting - zinc finger
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameRosa26 left targeting arm
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)796
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer M13_pUC-fwd (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMCS
Gene/Insert 3
-
Gene/Insert nameRosa26 right targeting arm
-
Insert Size (bp)815
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer NA
- 3′ sequencing primer M13_pUC-rev (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDonor MCS Rosa26 was a gift from Charles Gersbach (Addgene plasmid # 37200 ; http://n2t.net/addgene:37200 ; RRID:Addgene_37200) -
For your References section:
Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases. Perez-Pinera P, Ousterout DG, Brown MT, Gersbach CA. Nucleic Acids Res. 2012 Apr 1;40(8):3741-52. Epub 2011 Dec 14. 10.1093/nar/gkr1214 PubMed 22169954