pMB38-HF380
(Plasmid
#37332)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMB38
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 18500
-
Vector typeDictyostelium Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCytoplasmic Dynein Heavy Chain
-
SpeciesDictyostelium discoideum
-
Insert Size (bp)10126
-
Mutationdeleted amino acids 1-1387
-
Entrez GenedhcA (a.k.a. DDB_G0276355, DDBDRAFT_0166999, DDBDRAFT_0185096, DDB_0166999, DDB_0185096)
- Promoter TRE-Pmin
-
Tag
/ Fusion Protein
- His6 and FLAG tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer aatgttaactctgtaatga
- 3′ sequencing primer ggaacaatgatcaactcacacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The backbone plasmid MB38 was created by Mieke Blaauw and Peter van Haastert (Gene 252 (2000) 71–82).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB38-HF380 was a gift from Takahide Kon (Addgene plasmid # 37332 ; http://n2t.net/addgene:37332 ; RRID:Addgene_37332) -
For your References section:
The 2.8 A crystal structure of the dynein motor domain. Kon T, Oyama T, Shimo-Kon R, Imamula K, Shima T, Sutoh K, Kurisu G. Nature. 2012 Mar 7;484(7394):345-50. doi: 10.1038/nature10955. 10.1038/nature10955 PubMed 22398446