Skip to main content

pMB38-HF380deltaMTBD
(Plasmid #37333)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37333 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMB38
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 18000
  • Vector type
    Dictyostelium Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cytoplasmic Dynein Heavy Chain
  • Species
    Dictyostelium discoideum
  • Insert Size (bp)
    9760
  • Mutation
    deleted amino acids 1-1387 and replaced amino acids 3372-3495 to Thr-Gly
  • Entrez Gene
    dhcA (a.k.a. DDB_G0276355, DDBDRAFT_0166999, DDBDRAFT_0185096, DDB_0166999, DDB_0185096)
  • Promoter TRE-Pmin
  • Tag / Fusion Protein
    • His6 and FLAG tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer aatgttaactctgtaatga
  • 3′ sequencing primer ggaacaatgatcaactcacacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The backbone plasmid MB38 was created by Mieke Blaauw and Peter van Haastert (Gene 252 (2000) 71–82).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMB38-HF380deltaMTBD was a gift from Takahide Kon (Addgene plasmid # 37333 ; http://n2t.net/addgene:37333 ; RRID:Addgene_37333)
  • For your References section:

    The 2.8 A crystal structure of the dynein motor domain. Kon T, Oyama T, Shimo-Kon R, Imamula K, Shima T, Sutoh K, Kurisu G. Nature. 2012 Mar 7;484(7394):345-50. doi: 10.1038/nature10955. 10.1038/nature10955 PubMed 22398446