-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUAST
- Backbone size w/o insert (bp) 8904
-
Vector typeInsect Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesix STAT consensus sites
-
Alt name6XSTAT-synthetic-luc
-
SpeciesSynthetic
- Promoter Hsp70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer pUAST-5 (5'-CTGCAACTAAAATCTGCCAAGAAG-3') (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Perrimon Lab plasmid #445
To generate a reporter construct containing six STAT consensus
sites (TCCNNNGGA), two pairs of oligos—(1) TTCTGGGAAACCGTTTATACGCTGCGTTCGCGGAAACCGTTTATACGCTGCGTTCTGGGAAACCGTTTATAC, AACGGTTTCCCAGAACGCAGCGTATAAACGGTTTCCGCGAACGCAGCGTATAAACGGTTTCCCAGAATGCA and (2) GCTGCGTTCGCGGAAACCGTTTATACGCTGCGTTCTGGGAAACCGTTTATACGCTGCGTTCGCGGAA, AATTTTCCGCGAACGCAGCGTATAAACGGTTTCCCAGAACGCAGCGTATAAACGGTTTCCGCGAACGCAGCGTATA—were annealed, respectively, and cloned together into pUAST. Subsequently, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3–luciferase vector (Promega) and the hsp70 minimal promoter were subcloned into the resulting vector using XhoI/XbaI and NotI/XhoI sites, respectively, to generate the 6XSTAT–synthetic-luc construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6X-STAT-synthetic luciferase was a gift from Norbert Perrimon (Addgene plasmid # 37392 ; http://n2t.net/addgene:37392 ; RRID:Addgene_37392) -
For your References section:
Genome-wide RNAi analysis of JAK/STAT signaling components in Drosophila. Baeg GH, Zhou R, Perrimon N. Genes Dev. 2005 Aug 15;19(16):1861-70. Epub 2005 Jul 29. 10.1101/gad.1320705 PubMed 16055650