Skip to main content

pBad His6 MBP TEV LIC cloning vector (8C)
(Plasmid #37503)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37503 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size (bp) 6848
  • Vector type
    Bacterial Expression
  • Promoter araBAD arabinose
  • Tags / Fusion Proteins
    • His6 (N terminal on backbone)
    • MBP (N terminal on backbone)
    • TEV recognition (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer MBP F (5'ggtcgtcagactgtcgatgaagcc)
  • 3′ sequencing primer ARA Rv (5'ctgttttatcagaccgcttc)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted via LIC cloning.

8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.

8C adds a TEV-cleavable His6-MBP tag to the N-terminus of your protein. MBP can enhance the solubility of your protein of interest.

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad His6 MBP TEV LIC cloning vector (8C) was a gift from Scott Gradia (Addgene plasmid # 37503)