pHL1561
(Plasmid
#37571)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZ with p15a origin
-
Backbone manufacturerLim Lab
-
Modifications to backbonePlasmid modified from Rolf Lutz and Hermann Bujard, 1997
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCsrA
-
SpeciesE. coli
-
Insert Size (bp)186
-
Entrez GenecsrA (a.k.a. b2696, ECK2691, zfiA)
- Promoter pLtetO-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CAGTCATAGCCGAATAGCCT
- 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL1561 was a gift from Han Lim (Addgene plasmid # 37571 ; http://n2t.net/addgene:37571 ; RRID:Addgene_37571) -
For your References section:
Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244
Map uploaded by the depositor.