Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37571)


Item Catalog # Description Quantity Price (USD)
Plasmid 37571 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pZ with p15a origin
  • Backbone manufacturer
    Lim Lab
  • Modifications to backbone
    Plasmid modified from Rolf Lutz and Hermann Bujard, 1997
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Entrez Gene
    csrA (a.k.a. b2696, ECK2691, zfiA)
  • Promoter pLtetO-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGTCATAGCCGAATAGCCT
  • 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL1561 was a gift from Han Lim (Addgene plasmid # 37571 ; ; RRID:Addgene_37571)
  • For your References section:

    Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244