Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37633)


Item Catalog # Description Quantity Price (USD)
Plasmid 37633 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pZ with ColE origin
  • Backbone manufacturer
    Lim Lab
  • Modifications to backbone
    Plasmid modified from Rolf Lutz and Hermann Bujard, 1997
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    green fluorescent protein
  • Insert Size (bp)
  • Promoter pConM12NoHind
  • Tags / Fusion Proteins
    • ASV degradation tag (C terminal on backbone)
    • glgC leader region (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SphI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCATGA GCGGATACAT ATTTGAA
  • 3′ sequencing primer cgcggatcc AAGGCCATCCGTCAGGATGGCCTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Promoter pConNoHind

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
  • 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Insert Size (bp)
  • Entrez Gene
    csrA (a.k.a. b2696, ECK2691, zfiA)
  • Promoter pConNoHind

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer ggccaag CTT TAATC GTACAGGGTA GTACAAATA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL1668 was a gift from Han Lim (Addgene plasmid # 37633 ; ; RRID:Addgene_37633)
  • For your References section:

    Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244