Skip to main content

pHL 233
(Plasmid #37754)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37754 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE (from pZ system) + AmpR
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 5300
  • Vector type
    Synthetic Biology ; E. coli

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ptet_ompC_gfp
  • Species
    E. coli
  • Insert Size (bp)
    1800
  • Promoter ptet
  • Tag / Fusion Protein
    • gfp (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer ctcatgagcggatacat atttgaa
  • 3′ sequencing primer cgcggatcc TGAGCGGATACATATTTGAATGTA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pLac_st7 TetR_mCherry
  • Insert Size (bp)
    1500
  • Promoter pLac
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (destroyed during cloning)
  • 3′ cloning site Apa1 (not destroyed)
  • 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
  • 3′ sequencing primer agctgatacc gctcgccgca gccgaacg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gfp is from pTak 102 mCherry is from Tsein Lab TetR is from pjm31

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL 233 was a gift from Han Lim (Addgene plasmid # 37754 ; http://n2t.net/addgene:37754 ; RRID:Addgene_37754)
  • For your References section:

    Direct comparison of small RNA and transcription factor signaling. Hussein R, Lim HN. Nucleic Acids Res. 2012 May 22. 10.1093/nar/gks439 PubMed 22618873