pHL 279
(Plasmid
#37757)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneColE (from pZ system) + AmpR
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 5300
-
Vector typeSynthetic Biology ; E. coli
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameptet_ompC_gfp
-
SpeciesE. coli
-
Insert Size (bp)1800
- Promoter ptet
-
Tag
/ Fusion Protein
- gfp (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AatII (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer ctcatgagcggatacat atttgaa
- 3′ sequencing primer cgcggatcc TGAGCGGATACATATTTGAATGTA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepLac_st3 TetR_mCherry
-
Insert Size (bp)1500
- Promoter pLac
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site Apa1 (not destroyed)
- 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
- 3′ sequencing primer agctgatacc gctcgccgca gccgaacg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygfp is from pTak 102 mCherry is from Tsein Lab TetR is from pjm31
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL 279 was a gift from Han Lim (Addgene plasmid # 37757 ; http://n2t.net/addgene:37757 ; RRID:Addgene_37757) -
For your References section:
Direct comparison of small RNA and transcription factor signaling. Hussein R, Lim HN. Nucleic Acids Res. 2012 May 22. 10.1093/nar/gks439 PubMed 22618873