Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHL 1571
(Plasmid #37760)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 37760 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    ColE (from pZ system) + AmpR
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 5300
  • Vector type
    Synthetic Biology ; E. coli

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Mutation
    AaV degradation tag added to the 3'end
  • Promoter ptet
  • Tag / Fusion Protein
    • gfp (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (destroyed during cloning)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer ctcatgagcggatacat atttgaa
  • 3′ sequencing primer cgcggatcc TGAGCGGATACATATTTGAATGTA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pLac_st3 TetR_mCherry
  • Insert Size (bp)
  • Promoter pLac
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Apa1 (not destroyed)
  • 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
  • 3′ sequencing primer agctgatacc gctcgccgca gccgaacg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL 1571 was a gift from Han Lim (Addgene plasmid # 37760 ; ; RRID:Addgene_37760)
  • For your References section:

    Direct comparison of small RNA and transcription factor signaling. Hussein R, Lim HN. Nucleic Acids Res. 2012 May 22. 10.1093/nar/gks439 PubMed 22618873