pNG2470
(Plasmid
#37837)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 37837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPD49.26
-
Backbone manufacturerFire Lab
- Backbone size w/o insert (bp) 3410
- Total vector size (bp) 9497
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameF13D12.6(G166R)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)3224
-
MutationG166R, S168G
-
Entrez GeneF13D12.6 (a.k.a. CELE_F13D12.6)
- Promoter nhx-2
-
Tag
/ Fusion Protein
- YFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGCTCTCTCGTCTCTCTCTC
- 3′ sequencing primer CGTGTCTTGTAGTTCCCGTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNG2470 was a gift from Gary Silverman (Addgene plasmid # 37837 ; http://n2t.net/addgene:37837 ; RRID:Addgene_37837) -
For your References section:
A pro-cathepsin L mutant is a luminal substrate for endoplasmic-reticulum-associated degradation in C. elegans. Miedel MT, Graf NJ, Stephen KE, Long OS, Pak SC, Perlmutter DH, Silverman GA, Luke CJ. PLoS One. 2012;7(7):e40145. Epub 2012 Jul 2. 10.1371/journal.pone.0040145 PubMed 22768338