Skip to main content

pCA-FLEX
(Plasmid #38041)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38041 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CA-MCS
  • Backbone manufacturer
    Masatoshi Takeichi
  • Backbone size (bp) 4839
  • Modifications to backbone
    4 mutated lox sites (FLEX) were added with multi cloning sites BglII, HindIII, EcoRV and SalI
  • Vector type
    Mammalian Expression, Cre/Lox
  • Promoter CA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTACAGCTCCTGGGCAACG
  • 3′ sequencing primer ACCACAACTAGAATGCAGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA-FLEX was a gift from Naoshige Uchida (Addgene plasmid # 38041 ; http://n2t.net/addgene:38041 ; RRID:Addgene_38041)
  • For your References section:

    Whole-brain mapping of direct inputs to midbrain dopamine neurons. Watabe-Uchida M, Zhu L, Ogawa SK, Vamanrao A, Uchida N. Neuron. 2012 Jun 7;74(5):858-73. 10.1016/j.neuron.2012.03.017 PubMed 22681690